circad | circRNAs associated with diseases

hsa_circ_0025039
Gene	FOXM1	Organism	Human
Genome Locus	chr12:2975558-2977920:-	Build	hg19
Disease	Malignant Melanoma	ICD-10	Melanoma in situ (D03)
DBLink	Link to database	PMID	30219673
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	43 melanoma tumor samples and 18 paired adjacent normal tissues
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TTCCCTGCACGACATGTTTG Reverse CTCTCAGTGCTGTTGATGGC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Bian, D, Wu, Y, Song, G (2018). Novel circular RNA, hsa_circ_0025039 promotes cell growth, invasion and glucose metabolism in malignant melanoma via the miR-198/CDK4 axis. Biomed. Pharmacother., 108:165-176.